Home > Parse Error > Parse Error At Line Sequence And Quality Are Inconsistent

Parse Error At Line Sequence And Quality Are Inconsistent

Contents

Topics covered include: Web security, SSL, hacker attacks & Denial of Service (DoS), private keys, security Microsoft Exchange, secure Instant Messaging, and much more. I can't find it anywhere. [samopen] SAM header is present: 2957 sequences. I understand that I can withdraw my consent at any time. I can't find it anywhere. [samopen] SAM header is present: 2957 sequences. http://back2cloud.com/parse-error/parse-error-at-line-1-sequence-and-quality-are-inconsistent.php

That is > really confusing and I have searched SEQanswers but didn't find any > answers. if so, try removing -I from command. Counting mapped reads from a SAM file I am using BWA to align RNA-seq data from a miRNA experiment. I understand that I can withdraw my consent at any time. https://www.biostars.org/p/72880/

Samtools Manual

I tried without the -r and them without either the -r or -P option but still get a misformed sam file. Can't convert paired end BAM to bed using bedtools I'm trying to convert a bam file with paired end read alignments to bed format, which is required... Continue Type "show copying" to see the conditions.

All Rights Reserved. From: Kevin Lam - 2010-01-05 01:54:36 Attachments: Message as HTML I am using solid data with BWA as well. Thanks in advance! ADD REPLY • link written 3.4 years ago by Philipp Bayer ♦ 3.7k Dear Sir Philipp, I got what you want to say here, it might be possible that there may

Sign up for the SourceForge newsletter: I agree to receive quotes, newsletters and other information from sourceforge.net and its partners regarding IT services and products. Samtools Mpileup Where possible, you should pipe the output of whatever progam is making your .sam files (like bwa sampe, in your case) straight into samtools view. Please don't fill out this field. find more info Consolidate legacy IT systems to a single system of record for IT > 2.

In the past I'veseen non-printing control characters get incorporated into the basecall quality string (never from bwa). Please refer to our Privacy Policy or Contact Us for more details You seem to have CSS turned off. The time now is 03:40 PM. Picard tools is provided by samtools and is able to detect errors in the sam/bam files.

Samtools Mpileup

Here is the stripped-down program.... #include #include "sam.h" int main(int argc, char **argv) { samfile_t *sam = samopen(argv[1], "r", NULL); if(sam == NULL) { fprintf(stderr, "file open error: '%s'\n", argv[1]); https://sourceforge.net/p/bio-bwa/mailman/message/27834048/ A Error About Gatk Samfilereader Malformed I met some questions when using GATK -UnifiedGenoTyper to call SNPs. Samtools Manual So, I'm looking forward to your reply. ADD COMMENT • link modified 3.4 years ago • written 3.4 years ago by Philipp Bayer ♦ 3.7k 1 3.4 years ago by Alex Reynolds ♦ 15k Seattle, WA USA Alex

Your symptom is often the result of piping stderr to same same stdout in a previous process. http://back2cloud.com/parse-error/parse-error-at-line.php Parse error at line 1170: sequence and quality are inconsistent Any advice or is there a samtools email group ? For this I have tried using bwasw and the alignment runs fine. Consolidate legacy IT systems to a single system of record for IT 2.

Essentially, when I run the program on a .sam file generated by bwa aln and bwa samse, I get a warning message about a missing CIGAR sequence, and then an error No, thanks SourceForge Browse Enterprise Blog Deals Help Create Log In or Join Solution Centers Go Parallel Resources Newsletters Cloud Storage Providers Business VoIP Providers Call Center Providers Thanks for helping Sign up for the SourceForge newsletter: I agree to receive quotes, newsletters and other information from sourceforge.net and its partners regarding IT services and products. Check This Out I can't find it anywhere. > > [samopen] SAM header is present: 2957 sequences. > Parse error at line 3512359: sequence and quality are inconsistent > createbam.sh: line 1: 10236 Aborted

Note BTW that the mailing lists also host SAM specification, Picard, and other tools discussions as well as samtools, so moving them would cause quite a lot of disruption. Sign up for the SourceForge newsletter: I agree to receive quotes, newsletters and other information from sourceforge.net and its partners regarding IT services and products. Best wishes, Xiaolong ------------------------------------------------------------------------------ How ServiceNow helps IT people transform IT departments: 1.

They'll go into 2.00_10.

Now I encounter a question about SAMtools when I tried to convert .sam file into .bam file: $ samtools view -h accepted_hits.bam > zz.sam $ samtools view -bS zz.sam > zz.bam Pindel Segmentation Fault (Version 0.2.4W) I am using Pindel (version 0.2.4w) to detect SVs for a non-model system. So, I'm looking forward to your reply. Bad output is RG:Z:UACC812BTR_tumor1 which looks suspiciously like [emailprotected]\tID:XXXX_tumor1\tLB:XXXX_tumor\tSM:XXXX_tumor' Try running it without the -r and maybe -P parameters.

Kind Regards, Colin On 13 September 2013 11:03, 崔晓龙 wrote: > The line is something like this (not exactly the line 49709458 but a line > from another .sam file ADD REPLY • link written 3.3 years ago by Daniel Standage ♦ 3.6k Maybe using the BAMtools(c++) or Picard (Java) API is a bit more user-friendly (and documented). Briefly describe the problem (required): Upload screenshot of ad (required): Select a file, or drag & drop file here. ✔ ✘ Please provide the ad click URL, if possible: Home Browse this contact form How can I save the output from samtools and awk as a bam file?

Please don't fill out this field. Need to parse pooled bam file based on sequence I have a bam file (pool.bam) that represents PCR amplicons of many samples, pooled into one seque... Continue anyway. ##sed -n -e 3512359p S3-n4-o2-e2.sam S3:873_2032_219 16 21728357|ref|NC_004067.1| 6412 37 1S44M3D3M * 0 0 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCCCCG XT:A:U CM:i:3 X0:i:1 X1:i:0 XM:i:3 XO:i:1 XG:i:3 MD:Z:44^GAT3 On Mon, Jan 4, 2010 at when I checked corresponding read: [[email protected] bowtie2-2.1.0]$ sed -n '38967971p' at_wt.sam SRR681003.19483981 145 1 19313630 42 50M = 19461614 148034 TGATATGTTTCCATGGACGTTTGATTTCACCATGGAATCGAGAATCGAAC hiiiiiiih as I got from this line I think it

Myron myronpeto View Public Profile Send a private message to myronpeto Find More Posts by myronpeto 02-02-2012, 04:08 PM #6 Richard Finney Senior Member Location: bethesda Join Date: You seem to have CSS turned off. Terms Privacy Security Status Help You can't perform that action at this time. http://www.accelacomm.com/jaw/sfnl/114/51426210/ _______________________________________________ Bio-bwa-help mailing list [email protected]

Thanks in advance! GDB is free software, covered by the GNU General Public License, and you are welcome to change it and/or distribute copies of it under certain conditions. I have sucessfully trimmed out the ... You seem to have CSS turned off.

Parse error at line 3512359: sequence and quality are inconsistent createbam.sh: line 1: 10236 Aborted (core dumped) samtools view -bS -t virus-db.fasta.formatted.fixedlen.fa.fai S3-n4-o2-e2.sam -o S3-n4-o2-e2.bam [bam_header_read] EOF marker is absent. [bam_sort_core]