Home > Parse Error > Parse Error At Line Invalid Cigar Character

Parse Error At Line Invalid Cigar Character

The .sam files are obtained after BWA step. All rights reserved.About us · Contact us · Careers · Developers · News · Help Center · Privacy · Terms · Copyright | Advertising · Recruiting We use cookies to give you the best possible experience on ResearchGate. apply cufflinks to ENCODE RNA-Seq data Dear all, I am trying to analyze ENCODE RNA-seq data with cufflinks tool. The problem was indeed the input format which I was blindly assuming to be .sam from the aligner. have a peek here

Segmentation fault I'm using samtools 1.7 and maq 0.7.1 Anyone faced such case ? When you know the cause, you will find the solution. I can only think that the problem is the header of sam file. Got a question you need answered quickly?

But I have a problem when I use samtools to convert the sam files into bam inorder to check the statistics. I al... Faulty BAM/SAM files after Bowtie2, filtering and sorting Hi, I have some ChIP-seq data which I have aligned with Bowtie2 on Galaxy which gave me BAM file... I am using command $ samtools view -b -S -o bowtie.glob.bam bowtie.glob.sam but getting error Parse error at line 25645: invalid CIGAR character Could someone please help me to solve this

In particular, the chromosome identifiers must be an exact match. But when I try to import this file in samtools, the program returns me different errors. Demand the Impossible.www.wikiposon.org- -----------------------------------------UMR 5096 Génome et Développement des PlantesCentre IRD911, Av Agropolis BP 6450134394 Montpellier Cedex 5FrancePhone: +33 4 67 41 64 18- ----------------------------------------------BEGIN PGP SIGNATURE-----Version: GnuPG v1.4.10 (GNU/Linux)Comment: Using ADD REPLY • link written 3.6 years ago by Rohit • 620 0 3.7 years ago by Rohit • 620 European union Rohit • 620 wrote: Could you please try: samtools

Please don't fill out this field. ADD COMMENT • link written 3.7 years ago by SK • 100 Please log in to add an answer. All Rights Reserved. Meaning, it may have executed OK, but the results are poor.

I've made BAM file using TopHat2 and RefSeq mm10 gtf file for Junctions. Cuffdiff Fatal error: Matched on error Hello, I am doing my first RNA seq data analysis using galaxy. The time now is 03:40 PM. m_elena_bioinfo View Public Profile Send a private message to m_elena_bioinfo Find More Posts by m_elena_bioinfo 11-13-2009, 04:19 AM #6 ramouz87 Member Location: Doha, Qatar Join Date: Oct 2009 Posts:

It does not have the '@' headers. > >> > >> I'm trying to generate .bam with samtools view, but getting the following > >> error: > >> > >> ############################## https://groups.google.com/d/topic/rsem-users/OGu3SQYD77s Latest Open RNA-Seq ChIP-Seq SNP Assembly Tutorials Tools Jobs Forum Planet All » View Posts Latest Open RNA-Seq ChIP-Seq SNP Assembly Tutorials Tools Jobs Forum Planet All » Home what is the CIGAR string? > > What version of samtools do you have? > > My initial guess would have been an X/= which was not supported prior > to I want to visualize the alignment in IGV.

d dawe View Public Profile Send a private message to dawe Visit dawe's homepage! navigate here Sam To Bam Conversion Reference Fasta File Hello, I had some data in "eland_export.txt" format and I want to convert it to the SAM format f... This might help. I am running HTseq-count on galaxy cloud on some BAM files generated from galaxy Tophat.

My sam file after headers looks like this - scaffold1 4 * 0 0 * * 0 0 55278387 0 - 100 #DOWN 68667525:5:56 68667525 127 + 556 #DOWN 63995574:5:107 60040051:2:45 below is the lines 25640-25650 HWI-ST365_0135:2:1101:17649:2719#TACTAG-1 16 gnl|Cflo_3.3|scaffold1656 205450 42 28M66N22M * 00 GGAAGCTACGGCTGCTAATATTATGAAGGCCATCGTTTTGATAACTGGCG `\c_Ybb_be\gggggggggggggggggggggggggfggggggggggggg AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:50 YT:Z:UU HWI-ST365_0135:2:1101:17674:2720#TACTAG-2 16 gnl|Cflo_3.3|scaffold469 269161 42 19M495N31M * 00 All that you should do to make the process work is to go over the advance system Error In Sam To Bam Conversion - BioStar setting via control panel. Check This Out But if there's no issue with your RAM, all you have to do is to add some additional space in your page file.

invalid email (thinking…) Reset or sign in with UserVoice password Forgot password? ADD COMMENT • link modified 3.7 years ago by Alex Reynolds ♦ 15k • written 3.7 years ago by Rohit • 620 0 3.7 years ago by SK • 100 Germany The example quoted by the > error message looks like a line from Blast output > format to me.

DLL Files are Lost There are cases that files required to run certain programs are nowhere found causing DLL files to get lost.

Password Register FAQ Community Calendar Today's Posts Search You are currently viewing the SEQanswers forums as a guest, which limits your access. RNA-seq analysis in Galaxy I am doing RNA-seq analysis for several mouse samples and I encounter problems during differentia... How many input BAM files for Cuffquant? Create the index files with samtools faidx sequence.fa This creates the index file *.fai.

The result of this error normally causes the virtual memory to run slow. One possible solution is to remove these kind of lines. dawe View Public Profile Send a private message to dawe Visit dawe's homepage! this contact form Cheers...

Thanks, Ken Research Fellow School of Molecular Bioscience University of Sydney Phone: +61-2-9354-1321 Re: [Samtools-help] invalid CIGAR character error From: Peter Cock - 2011-09-14 11:35:14 On Wed, Sep 14, 2011 Parse error at line 9962791: sequence and quality are inconsistent [bam_sort_core] merging from 7 files... [samopen] SAM header is present: 25 sequences. [sam_read1] reference 'XU:i:1' is recognized as '*'. Problem with Filter SAM or BAM, output SAM or BAM files on FLAG MAPQ RG LN or by region (Galaxy Version 1.1.1) First i don't know if this is the correct Find More Posts by dawe 11-12-2009, 04:00 AM #3 m_elena_bioinfo Member Location: Ospedali Riuniti di Bergamo, ITALY Join Date: Oct 2009 Posts: 99 Hi dawe, thank you very much.

Parse error at line 1: invalid CIGAR character Segmentation fault m_elena_bioinfo View Public Profile Send a private message to m_elena_bioinfo Find More Posts by m_elena_bioinfo 11-12-2009, 04:18 AM #4 what is the CIGAR string? > > > > What version of samtools do you have? > > > > My initial guess would have been an X/= which was not Note that fileout has no extension as it is automagically appended by samtools.