Home > Parse Error > Parse Error At Line 1 Unmatched Cigar Operation

Parse Error At Line 1 Unmatched Cigar Operation

Feb 27, 2013 Shishir K Gupta · Universität Heidelberg Thanks for your reply.. SRA Toolkit and bowtie2: 0.00% overall alignment rate - what am I missing? Parse error at line 4698: unmatched CIGAR operation" ADD REPLY • link written 3.8 years ago by GPR • 270 The "something is recognized as *"-error in samtools happens when you Forgot to mention that... have a peek here

output/ [emailprotected]:/host/Users/chris.wall/Desktop/Mastigo-genomics/bwa_cw$ sed '18750816,18750818!d' WC.sam ILLUMINA-2F52BD:6:50:1169:1446#0 163 NODE_37776_length_48465_cov_160.191483\par 35442 29 59M = 35600 217 TTTTATCGGTGTGTATCGGTGTGTATCGGTGGGCGAGTTTTCAACAAGATTATGGGGCA gggfggggfdae[_aee_eeZ_^]_`aaeS]\FY\`dWZ]_^`_`WcSZXg`dgfcbYV XT:A:U NM:i:2 SM:i:0 AM:i:0 X0:i:1 X1:i:2 XM:i:2 XO:i:0 XG:i:0 MD:Z:7T27G23 ILLUMINA-2F52BD:6:50:1169:1947#0 83 NODE_51983_length_172857_cov_173.044144\par 119160 60 Content Search Users Tags Badges Help About FAQ Access RSS Stats API Use of this site constitutes acceptance of our User Agreement and Privacy Policy. The 5th and the 11th column for the scaffold alignment has a 0, do I replace the whole 11th column with a star??? bowtie problem: cannot locate bowtie index Hi everyone, I actually have three minor questions about bowtie.  I wrote a run.sh file as follo... https://sourceforge.net/p/samtools/mailman/message/28368407/

I am trying to convert a sam file to bam using the line of code described [here][1], but samtools... Seem the problem is from bwasw. But I have a problem when I use samtools to convert the sam files into bam inorder to check the statistics. sam to bam conversion Hi I could extract the unmapped reads from the bwa-mem alignment file in SAM format using below ...

Bowtie 2 Error Hai all,   I am new to ngs works. All Rights Reserved. I'm just getting started with bioinformatics and this is my first post on Biostars. Table 'N-Reads=F(Duplicate,Sample) ' How Can I Visualize This ?

Trying to filter vcf file using SNPSIFT tool. Please don't fill out this field. If I were you, I would look at the immediately preceding few lines in the file and figure out why the file is being parsed this way. http://www.freelists.org/post/mira_talk/Parse-error-at-line-84-unmatched-CIGAR-operation,1 CIGAR and query sequence are of different length when trying to convert from sam to bam?

Parsing in perl - separate output to two files This may be the wrong webpage to be posting this kind of question since it relates specifically t... It looks like you mistakenly aligned the reads to another set of reads, as the reference-name "HWI-ST974:67:C0545ACXX:2:1101:11263:2144" is a standard name for a read and not a chromosome or anything else. Sam To Bam I sequenced a mito genome using paired end method on the mi-seq I mapped all the reads back to re... Again, I appreciate your willingness to help.

Tophat-Fusion Sam To Bam Error Hi, After the execution of tophat-fusion. https://www.biostars.org/p/90436/ This might help. If the latter, then I think samtools view is reading your reads as references. Error in sam to bam conversion after bowtie alignment I used this command line in bowtie: bowtie -v 0 -m 1 ref file1.fastq file2.sam and now I'm try...

ADD REPLY • link written 2.8 years ago by Istvan Albert ♦♦ 66k Really sorry for the late reply Istvan (crashed again)... http://back2cloud.com/parse-error/parse-error-last-line-php.php Peter -- You have received this mail because you are subscribed to the mira_talk mailing list. What program generated the SAM file? I downloaded fasta files from NCBI from an SRA ...

Rna-Seq Data Normalization With Spike-In Using Deseq Hi, I need some inputs in normalizing the RNA-Seq data with spike-ins and using the DESeq to ret... Toggle navigation Home Create Find and Join Admin Login Help About FAQ Docs Privacy Policy Contact Us [mira_talk] Re: Parse error at line 84: unmatched CIGAR operation From: Peter Cock Create the index files with samtools faidx sequence.fa This creates the index file *.fai. Check This Out I was trying to add Read Group to a SAM file by Picard and i got t...

I've been trying for awhile to train my features get the... Powered by Biostar version 2.3.0 Traffic: 629 users visited in the last hour For full functionality of ResearchGate it is necessary to enable JavaScript. You seem to have CSS turned off.

Again, what is the problem SAM line itself. > D.

I want to convert Sam file into Bam. This is a snapshot. << HWI-ST974:67:C0545ACXX:2:1101:14321:25195 0 chr2 242170185 255 76M * 0 0 CCATGATTTTGCGAATGGCTTTGCCGCGGGCACCAATGATGCGGGCGTGAACGCGGTGGTCCAGCGGGACGTCCTC CCCFFFFFHHHHHIJJIGIIJFIHIIIIGIIJIEHIFHHHHHFFDBB; > ADD REPLY • link written 3.8 years ago by GPR How Can I Convert Bam To Sam? Can these fusion predictions by tophat be trusted Hi, I have got these results from tophat-fusion: chr15-chr17 74317267 38506035 ff ...

awk '{if($0~/^@/){print}else if($6!~/\./){print}}' INPUT_FILE >OUTPUT_FILE Hope this solves your issue.... ADD REPLY • link modified 2.8 years ago • written 2.8 years ago by Rohit • 620 1 This does not seem to be a valid SAM file (see the SAM I am enjoying learning, though error messages leave me at a loss. http://back2cloud.com/parse-error/parse-error-at-line-invalid-cigar-character.php Funny huh??

Error when trying to use samtools to convert a sam files to a bam file  I am attempting to convert a SAM file that I obtained as output from Bowtie, in I reverse complemented sequences in a fastq file using fastx r... The relevant snippet from the bowtie documentation is: 'Intuitively, the -m option, when combined with the --best and --strata options, guarantees a principled, though weaker form of "uniqueness." A stronger form ADD REPLY • link written 3.6 years ago by Rohit • 620 0 3.7 years ago by Rohit • 620 European union Rohit • 620 wrote: Could you please try: samtools

rgreq-abbd4f9e589f4ce9bf3ffec6022bbc58 false Javascript Required for Galaxy The Galaxy analysis interface requires a browser with Javascript enabled. IGV can't view SAM file I'm trying to view SAM files I have got after alignment using IGV.  When I try to load the SAM fi... genes count in sam file using htseq-count I run the htseq-count htseq-count -s no .sam genes.gtf > counts.txt And I  ... Tophat2 Error when moving from UCSC to NONCODE annotation When I used a UCSC gtf file and fasta file (genome.fa) to run tophat2, I was able to run it witho...

For information on how to subscribe or unsubscribe, please visit http://www.chevreux.org/mira_mailinglists.html Follow-Ups: [mira_talk] Re: Parse error at line 84: unmatched CIGAR operationFrom: John Nash References: [mira_talk] Parse error at line 84: