Home > Parse Error > Parse Error At Line 1 Missing Colon In Auxiliary Data

Parse Error At Line 1 Missing Colon In Auxiliary Data

Contents

Click here follow the steps to fix Parse Error At Line 1 Missing Colon In Auxiliary Data and related errors. Briefly describe the problem (required): Upload screenshot of ad (required): Select a file, or drag & drop file here. ✔ ✘ Please provide the ad click URL, if possible: Home Browse I need to convert it to a bam file, index it an do down... Parse error at line 1: missing colon in auxiliary data Kindly help Regards Ankur anaqib2 View Public Profile Send a private message to anaqib2 Find More Posts by anaqib2 11-25-2013, http://back2cloud.com/parse-error/parse-error-missing-opening.php

Password Register FAQ Community Calendar Today's Posts Search You are currently viewing the SEQanswers forums as a guest, which limits your access. All the above actives may result in the deletion or corruption of the entries in the windows system files. Any unauthorized copying, disclosure or distribution of the material in this e-mail is strictly forbidden and possibly a violation of federal or state law and regulations. What causes Parse Error At Line 1 Missing Colon In Auxiliary Data error?

Samtools Parse Error At Line 1

Please refer to our Privacy Policy or Contact Us for more details You seem to have CSS turned off. Sign up for the SourceForge newsletter: I agree to receive quotes, newsletters and other information from sourceforge.net and its partners regarding IT services and products. Mapping to the transcriptome using Bowtie - am I doing it right?

Start your 15-day FREE TRIAL of AppDynamics Pro! I used the command... You seem to have CSS turned off. Samtools View If it is the case how can I tell Bowtie not to included such reads in the SAM file in order for me to be able to generate the BAM file?

If so, a quick fix might be to re-compileusing locale "C". W Sam_read1 Parse Error At Line Thanks On Fri, Jul 5, 2013 at 5:19 AM, John Marshall wrote: > On 5 Jul 2013, at 04:45, jbr950 wrote: > > samtools view -bS file.sam > file.bam > In the past I'veseen non-printing control characters get incorporated into the basecall quality string (never from bwa). https://sourceforge.net/p/bio-bwa/mailman/message/31803286/ An incomplete installation, an incomplete uninstall, improper deletion of applications or hardware.

bowtie -v 2 -k 10 --best -S -f file.fasta file.sam This was the case for quite a few reads. Bwa Hi Everyone, I have a Bacterial RNA-seq data, I aligned it against the bacterial genome (BWA) and... If you are not the intended recipient (or have received this e-mail in error) please notify the sender immediately and destroy this e-mail. Empty SomaticSniper Output Files Hi all, I have a pipeline which I have written in python to do SNP calling and annotation.  The ...

W Sam_read1 Parse Error At Line

Parse error at line 85: missing colon in auxiliary data Aborted (core dumped) Here is that line (85): HWI-ST1097:95:D0U82ACXX:7:1101:1400:2239 16 X 38482098 60 101M * 0 0 CTCTGCAAAATGATATGCAAGTATTAGTTGTGTGTATATTTCTGTTTGTTTGGGATAGCCTTGCCTACTGAAGAGCATAAGAAGCTGGGTTTCTCCTCATT ######################################@=39ABC;>B;D8?0?09*?109D:11*11::1*:22+AC?C<3+3?A:+CD?>BD>DAD Could Any One Explain What Information Inside Sam File? Samtools Parse Error At Line 1 Thanks. [main_samview] Truncated File. If you show us your bwa command line and the version of bwa you're using, we may be able to figure that out.

Empty Cfg File For Breakdancer I have some paired-end alignment data from BWA, and I am trying to use BreakDancer to call struct... navigate here Blackwell 2013-02-05 12:43:10 UTC PermalinkRaw Message "sequence and quality are inconsistent" probably is triggered by arecord where the string of base call quality values has a differentnumber of characters from the John -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose burt Bioinformatics 11 11-25-2012 03:53 PM Thread Tools 10-20-2011, 01:57 AM #1 manore Member Location: paris Join Date: Jun 2011 Posts: 19 error with sam output ->Parse error Missing Sam Header

Removing the -r flag produces a sam file that works. Just guessing.- tom blackwell -"sequence and quality are inconsistent" probably is triggered by a recordwhere the string of base call quality values has a different number ofcharacters from the string of If you are the intended recipient, further disclosures are prohibited without proper authorization. Check This Out I would experiment with afew lines around the one named in the error message, looking for aninstance where the number of characters differs.

Thanks! The @RG header in the SAM output you included in your previous email: > @RG ID: LB: SM: PL:ILLUMINA > D3B4KKQ1:406:H0YE0ADXX:2:1101:1198:2135 89 chr8 124262197 37 101M = 124262197 0 GACATACAGTATTAAACTGGACTGAATATGAGGANAANCTCTAGTGGTCATTAAACCCCCTCAGAAAGTCTAAGATTCAGAATGTCTCCATCATATTAGAA CEEEEEDCADCCDECCCCCCDCDCDC>A>==5,,#5,#>@[email protected]@@ Sam To Bam Conversion BWA Version : 0.7.0-r313 Picard Version 1.108 samtools Version : 0.1.19-44428cd 1.I have creat...

Most IT organizations don't have a clear picture of how application performance affects their revenue.

Compatibility: Windows 7, 8, Vista, XP Download Size: 6MB Requirements: 300 MHz Processor, 256 MB Ram, 22 MB HDD Limitations: This download is a free evaluation version. Content Search Users Tags Badges Help About FAQ Access RSS Stats API Use of this site constitutes acceptance of our User Agreement and Privacy Policy. Hope this helps noms View Public Profile Send a private message to noms Find More Posts by noms 02-07-2013, 05:09 AM #9 visserm Junior Member Location: South Africa John -- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a company registered in England with number 2742969, whose

Next, I*samtools view -bS file.sam > file.bam*using samtools version 0.1.18 (r982:295).I could convert 443 out of the SAMs into BAMs without any complaints, butget 5 different error messages for the remaining Parse error at line xxxxx: missing colon in auxiliary data Aborted manore View Public Profile Send a private message to manore Find More Posts by manore 10-20-2011, 03:36 AM This is technically invalid in the current SAM specification (though there is no real reason for disallowing it, and I would mildly advocate for relaxing that), and samtools rejects it. http://back2cloud.com/parse-error/parse-error-on-last-line-php.php This information is intended only for the use of the individual(s) and entity(ies) to whom it is addressed.

This tool will scan and diagnose, then repairs, your PC with patent pending technology that fix your windows operating system registry structure. The Parse Error At Line 1 Missing Colon In Auxiliary Data error may be caused by windows system files damage.