Home > Parse Error > Parse Error At Line 1 Invalid Cigar Character

Parse Error At Line 1 Invalid Cigar Character

Similar posts • Search » What does this HTseq-count error mean? When you know the cause, you will find the solution. At the moment, I am using this com... I did not get any bug dat... http://back2cloud.com/parse-error/parse-error-at-line-invalid-cigar-character.php

Join for free An error occurred while rendering template. Got a question you need answered quickly? Technical questions like the one you've just found usually get answered within 48 hours on ResearchGate. Make certain that all inputs are based on the same reference genome.

Demand the Impossible.www.wikiposon.org- -----------------------------------------UMR 5096 Génome et Développement des PlantesCentre IRD911, Av Agropolis BP 6450134394 Montpellier Cedex 5FrancePhone: +33 4 67 41 64 18- ----------------------------------------- 2 Replies 47 Views Switch to And the sameproblem came up with the satble last version of samtools...Can you help me ?FrancoisPS: I used BWA 0.5.8a for my mapping-------------------------------------------------------------------------------Start uncovering the many advantages of virtual appliancesand start You seem to have CSS turned off. Thanks Ramzi Last edited by ramouz87; 11-13-2009 at 04:20 AM.

Powered by Biostar version 16.09 Traffic: 37 users visited in the last hour [Crac-bugs] [CRAC 1.3.0] samtools conversion Laurent MANCHON lmanchon at univ-montp2.fr Mar 11 Juin 16:02:32 CEST 2013 Message prcdent: Thanks, Ken Research Fellow School of Molecular Bioscience University of Sydney Phone: +61-2-9354-1321 Re: [Samtools-help] invalid CIGAR character error From: Peter Cock - 2011-09-14 11:35:14 On Wed, Sep 14, 2011 Reason: ver ramouz87 View Public Profile Send a private message to ramouz87 Find More Posts by ramouz87 11-19-2010, 07:10 AM #7 m_elena_bioinfo Member Location: Ospedali Riuniti di Bergamo, The example quoted by the > error message looks like a line from Blast output > format to me.

But I was told are responsible for not allowing conversion to bam. Every specific Parse Error At Line 1 Invalid Cigar Character has its own unique reasons. Read our cookies policy to learn more.OkorDiscover by subject areaRecruit researchersJoin for freeLog in EmailPasswordForgot password?Keep me logged inor log in with ResearchGate is the professional network for scientists and researchers. https://sourceforge.net/p/samtools/mailman/message/28089576/ htseq-count no hits Hello, I'm having quite abit of trouble handling my RNAseq fastq files.

Abort! >samtools view -S aln.sam prova.bam [samopen] no @SQ lines in the header. [main_samview] random alignment retrieval only works for indexed BAM files. Powered by Biostar version 2.3.0 Traffic: 630 users visited in the last hour For full functionality of ResearchGate it is necessary to enable JavaScript. For mapped reads, an extra blast-like output was added below the .sam format line: HWI-ST945_0069:2:1101:5660:19675#GNNGNN 0 ref1 1946 54 30H15M1I7M47H * 0 0 GGAAAGTGACACCAAGAAGTTCA ihiiihfghhhifghgfhhfhhh AS:i:18 QUERY: 31 GGAAAGTGACACCAAGAAGTTCA 53 - I can't convert SAM to BAM.

User support for Galaxy! https://groups.google.com/d/topic/rsem-users/OGu3SQYD77s We've just sent you an email to . Feb 27, 2013 Can you help by adding an answer? DLL Files are Lost There are cases that files required to run certain programs are nowhere found causing DLL files to get lost.

But I go... navigate here But when I try to import this file in samtools, the program returns me different errors. Note that fileout has no extension as it is automagically appended by samtools. invalid email (thinking…) Reset or sign in with UserVoice password Forgot password?

To be able to fix this PC problem, you need to update your anti-virus. Segmentation fault I'm using samtools 1.7 and maq 0.7.1 Anyone faced such case ? Please don't fill out this field. Check This Out BSoD This kind of Parse Error At Line 1 Invalid Cigar Character may not be new to you.

The most essential thing is to know what causes the problem you will have an idea how to avoid it from getting worse. What is going on exactly is not exact clear - except that the BAM dataset is almost certainly incomplete for some reason. And the same problemcame up with the satble last version of samtools...Can you help me ?FrancoisPS: I used BWA 0.5.8a for my mapping- --- --------------------------------------------------------Francois Sabot, PhDBe realistic.

I used Tophat2 in my work.

One solution is buying additional RAM chips to increase RAM space. May 20, 2011 Galaxy Development News Brief May 20, 2011 Galaxy Development News Brief http://bitbucket.org/galaxy/galaxy- central/wiki/Fea... The result of this error normally causes the virtual memory to run slow. Parse error at line 1: invalid CIGAR character Segmentation fault m_elena_bioinfo View Public Profile Send a private message to m_elena_bioinfo Find More Posts by m_elena_bioinfo 11-12-2009, 04:18 AM #4

what is the CIGAR string? > > > > What version of samtools do you have? > > > > My initial guess would have been an X/= which was not BAM file not working with Cufflinks or IGV Hello Galaxy Team, I am a complete novice at this, and have been unable to find the answer to my... Similar posts • Search » Error In Converting Sam To Bam By Samtools hello every one, after mapping,i encountered an error during converting my sam out file into bam... this contact form HTSeq-Count on Command Line Dear all So basically, I have a .bam file(cut_L7_1_5.bam) and i installed HTSeq-Count onto my lo...

You seem to have CSS turned off. Screenshot instructions: Windows Mac Red Hat Linux Ubuntu Click URL instructions: Right-click on ad, choose "Copy Link", then paste here → (This may not be possible with some types of If you simply have to download, the most important thing to consider is the reliability of your source. Meaning, it may have executed OK, but the results are poor.

Sign up today to join our community of over 11+ million scientific professionals. This Galaxy wiki has advice if you need to understand how to investigate: Reference Genomes and Mismatch Issues Hopefully this helps! Please compare the input to the spec in: > samtools.sourceforge.net/SAM1.pdf. > > - tom blackwell - > > On Wed, 14 Sep 2011, Peter Cock wrote: > > > On Wed, The Cufflinks docume...

It does not have the '@' headers. How to fi... Latest Open RNA-Seq ChIP-Seq SNP Assembly Tutorials Tools Jobs Forum Planet All » View Posts Latest Open RNA-Seq ChIP-Seq SNP Assembly Tutorials Tools Jobs Forum Planet All » Home It does not have the '@' headers. > >> > >> I'm trying to generate .bam with samtools view, but getting the following > >> error: > >> > >> ##############################

Please don't fill out this field. I'm using samtools-0.1.7 if I run: >samtools import reference.fasta.fai aln.sam prova.bam the error is [sam_header_read2] 735 sequences loaded.